
                                   remap 



Function

   Display restriction enzyme binding sites in a nucleotide sequence

Description

   remap scans one or more nucleotide sequences for recognition sites
   and/or cut sites for a supplied set of restriction enzymes. One or
   more restriction enzymes can be specified or alternatively all the
   enzymes in the REBASE database can be investigated. The minimum length
   of a recognition site to be reported must be specified. It writes an
   output file showing the location of the cut sites and (optionally) the
   recognition sites. Sites on both strands are shown by default but
   there are many options to control exactly what sites are reported and
   the format of the output file. Optionally, the translated sequence is
   reported. Additionally, the output file lists enzymess that cut / do
   not cut the sequence and which match / do not matching certain
   specified criteria.

Usage

   Here is a sample session with remap

   This example uses only a small region of the input sequence to save
   space. This is run with a small test version of the restriction enzyme
   database and so you will probably see more enzymes when you run this.


% remap -notran -sbeg 1 -send 60 
Display restriction enzyme binding sites in a nucleotide sequence
Input nucleotide sequence(s): tembl:j01636
Comma separated enzyme list [all]: taqi,bsu6i,acii,bsski
Minimum recognition site length [4]: 
Output file [j01636.remap]: 

   Go to the input files for this example
   Go to the output files for this example

   Example 2

   This is an example where all enzymes in the REBASE database are used,
   (but only the prototypes of the isoschizomers are reported by
   default). This is run with a small test version of the restriction
   enzyme database and so you will probably see more enzymes when you run
   this.


% remap -notran -sbeg 1 -send 60 
Display restriction enzyme binding sites in a nucleotide sequence
Input nucleotide sequence(s): tembl:j01636
Comma separated enzyme list [all]: 
Minimum recognition site length [4]: 
Output file [j01636.remap]: 

   Go to the output files for this example

   Example 3

   This is an example where all enzymes in the REBASE database are used
   but the -limit qualifier is not set so that all of the enzymes are
   displayed and not just only the prototypes of the isoschizomers. This
   is run with a small test version of the restriction enzyme database
   and so you will probably see more enzymes when you run this.


% remap -notran -sbeg 1 -send 60 -nolimit 
Display restriction enzyme binding sites in a nucleotide sequence
Input nucleotide sequence(s): tembl:j01636
Comma separated enzyme list [all]: 
Minimum recognition site length [4]: 
Output file [j01636.remap]: 

   Go to the output files for this example

   Example 4

   This shows the 'flat' format: This is run with a small test version of
   the restriction enzyme database and so you will probably see more
   enzymes when you run this.


% remap -notran -sbeg 1 -send 60 -flat 
Display restriction enzyme binding sites in a nucleotide sequence
Input nucleotide sequence(s): tembl:j01636
Comma separated enzyme list [all]: 
Minimum recognition site length [4]: 
Output file [j01636.remap]: 

   Go to the output files for this example

Command line arguments

   Standard (Mandatory) qualifiers:
  [-sequence]          seqall     Nucleotide sequence(s) filename and optional
                                  format, or reference (input USA)
   -enzymes            string     [all] The name 'all' reads in all enzyme
                                  names from the REBASE database. You can
                                  specify enzymes by giving their names with
                                  commas between then, such as:
                                  'HincII,hinfI,ppiI,hindiii'.
                                  The case of the names is not important. You
                                  can specify a file of enzyme names to read
                                  in by giving the name of the file holding
                                  the enzyme names with a '@' character in
                                  front of it, for example, '@enz.list'.
                                  Blank lines and lines starting with a hash
                                  character or '!' are ignored and all other
                                  lines are concatenated together with a comma
                                  character ',' and then treated as the list
                                  of enzymes to search for.
                                  An example of a file of enzyme names is:
                                  ! my enzymes
                                  HincII, ppiII
                                  ! other enzymes
                                  hindiii
                                  HinfI
                                  PpiI (Any string is accepted)
   -sitelen            integer    [4] This sets the minimum length of the
                                  restriction enzyme recognition site. Any
                                  enzymes with sites shorter than this will be
                                  ignored. (Integer from 2 to 20)
  [-outfile]           outfile    [*.remap] Output file name

   Additional (Optional) qualifiers:
   -mincuts            integer    [1] This sets the minimum number of cuts for
                                  any restriction enzyme that will be
                                  considered. Any enzymes that cut fewer times
                                  than this will be ignored. (Integer from 1
                                  to 1000)
   -maxcuts            integer    [2000000000] This sets the maximum number of
                                  cuts for any restriction enzyme that will
                                  be considered. Any enzymes that cut more
                                  times than this will be ignored. (Integer up
                                  to 2000000000)
   -single             boolean    [N] If this is set then this forces the
                                  values of the mincuts and maxcuts qualifiers
                                  to both be 1. Any other value you may have
                                  set them to will be ignored.
   -[no]blunt          boolean    [Y] This allows those enzymes which cut at
                                  the same position on the forward and reverse
                                  strands to be considered.
   -[no]sticky         boolean    [Y] This allows those enzymes which cut at
                                  different positions on the forward and
                                  reverse strands, leaving an overhang, to be
                                  considered.
   -[no]ambiguity      boolean    [Y] This allows those enzymes which have one
                                  or more 'N' ambiguity codes in their
                                  pattern to be considered
   -plasmid            boolean    [N] If this is set then this allows searches
                                  for restriction enzyme recognition site and
                                  cut postions that span the end of the
                                  sequence to be considered.
   -[no]commercial     boolean    [Y] If this is set, then only those enzymes
                                  with a commercial supplier will be searched
                                  for. This qualifier is ignored if you have
                                  specified an explicit list of enzymes to
                                  search for, rather than searching through
                                  'all' the enzymes in the REBASE database. It
                                  is assumed that, if you are asking for an
                                  explicit enzyme, then you probably know
                                  where to get it from and so all enzymes
                                  names that you have asked to be searched
                                  for, and which cut, will be reported whether
                                  or not they have a commercial supplier.
   -table              menu       [0] Genetic code to use (Values: 0
                                  (Standard); 1 (Standard (with alternative
                                  initiation codons)); 2 (Vertebrate
                                  Mitochondrial); 3 (Yeast Mitochondrial); 4
                                  (Mold, Protozoan, Coelenterate Mitochondrial
                                  and Mycoplasma/Spiroplasma); 5
                                  (Invertebrate Mitochondrial); 6 (Ciliate
                                  Macronuclear and Dasycladacean); 9
                                  (Echinoderm Mitochondrial); 10 (Euplotid
                                  Nuclear); 11 (Bacterial); 12 (Alternative
                                  Yeast Nuclear); 13 (Ascidian Mitochondrial);
                                  14 (Flatworm Mitochondrial); 15
                                  (Blepharisma Macronuclear); 16
                                  (Chlorophycean Mitochondrial); 21 (Trematode
                                  Mitochondrial); 22 (Scenedesmus obliquus);
                                  23 (Thraustochytrium Mitochondrial))
   -frame              menu       [6] This allows you to specify the frames
                                  that are translated. If you are not
                                  displaying cut sites on the reverse sense,
                                  then the reverse sense translations will not
                                  be displayed even if you have requested
                                  frames 4, 5 or 6. By default, all six frames
                                  will be displayed. (Values: 1 (1); 2 (2); 3
                                  (3); F (Forward three frames); -1 (-1); -2
                                  (-2); -3 (-3); R (Reverse three frames); 6
                                  (All six frames))
   -[no]cutlist        boolean    [Y] This produces lists in the output of the
                                  enzymes that cut, those that cut but are
                                  excluded because that cut fewer times than
                                  mincut or more times than maxcut and those
                                  enzymes that do not cut.
   -flatreformat       boolean    [N] This changes the output format to one
                                  where the recognition site is indicated by a
                                  row of '===' characters and the cut site is
                                  pointed to by a '>' character in the
                                  forward sense, or a '<' in the reverse sense
                                  strand.
   -[no]limit          boolean    [Y] This limits the reporting of enzymes to
                                  just one enzyme from each group of
                                  isoschizomers. The enzyme chosen to
                                  represent an isoschizomer group is the
                                  prototype indicated in the data file
                                  'embossre.equ', which is created by the
                                  program 'rebaseextract'. If you prefer
                                  different prototypes to be used, make a copy
                                  of embossre.equ in your home directory and
                                  edit it. If this value is set to be false
                                  then all of the input enzymes will be
                                  reported. You might like to set this to
                                  false if you are supplying an explicit set
                                  of enzymes rather than searching 'all' of
                                  them.

   Advanced (Unprompted) qualifiers:
   -[no]translation    boolean    [Y] This displays the 6-frame translations
                                  of the sequence in the output.
   -[no]reverse        boolean    [Y] This displays the cut sites and
                                  translation of the reverse sense.
   -orfminsize         integer    [If this value is left as 0 then all of the
                                  translation is shown.] This sets the minimum
                                  size of Open Reading Frames (ORFs) to
                                  display in the translations. All other
                                  translation regions are masked by changing
                                  the amino acids to '-' characters. (Integer
                                  0 or more)
   -uppercase          range      [If this is left blank, then the sequence
                                  case is left alone.] Regions to put in
                                  uppercase.
                                  If this is left blank, then the sequence
                                  case is left alone.
                                  A set of regions is specified by a set of
                                  pairs of positions.
                                  The positions are integers.
                                  They are separated by any non-digit,
                                  non-alpha character.
                                  Examples of region specifications are:
                                  24-45, 56-78
                                  1:45, 67=99;765..888
                                  1,5,8,10,23,45,57,99
   -highlight          range      [(full sequence)] Regions to colour if
                                  formatting for HTML.
                                  If this is left blank, then the sequence is
                                  left alone.
                                  A set of regions is specified by a set of
                                  pairs of positions.
                                  The positions are integers.
                                  They are followed by any valid HTML font
                                  colour.
                                  Examples of region specifications are:
                                  24-45 blue 56-78 orange
                                  1-100 green 120-156 red
                                  A file of ranges to colour (one range per
                                  line) can be specifed as '@filename'.
   -threeletter        boolean    [N] Display protein sequences in
                                  three-letter code
   -number             boolean    [N] Number the sequences
   -width              integer    [60] Width of sequence to display (Integer 1
                                  or more)
   -length             integer    [0] Line length of page (0 for indefinite)
                                  (Integer 0 or more)
   -margin             integer    [10] Margin around sequence for numbering
                                  (Integer 0 or more)
   -[no]name           boolean    [Y] Set this to be false if you do not wish
                                  to display the ID name of the sequence
   -[no]description    boolean    [Y] Set this to be false if you do not wish
                                  to display the description of the sequence
   -offset             integer    [1] Offset to start numbering the sequence
                                  from (Any integer value)
   -html               boolean    [N] Use HTML formatting

   Associated qualifiers:

   "-sequence" associated qualifiers
   -sbegin1            integer    Start of each sequence to be used
   -send1              integer    End of each sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -sformat1           string     Input sequence format
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name

   "-outfile" associated qualifiers
   -odirectory2        string     Output directory

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write first file to standard output
   -filter             boolean    Read first file from standard input, write
                                  first file to standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages

Input file format

  Input files for usage example

   'tembl:j01636' is a sequence entry in the example nucleic acid
   database 'tembl'

  Database entry: tembl:j01636

ID   J01636; SV 1; linear; genomic DNA; STD; PRO; 7477 BP.
XX
AC   J01636; J01637; K01483; K01793;
XX
DT   30-NOV-1990 (Rel. 26, Created)
DT   09-SEP-2004 (Rel. 81, Last updated, Version 8)
XX
DE   E.coli lactose operon with lacI, lacZ, lacY and lacA genes.
XX
KW   acetyltransferase; beta-D-galactosidase; galactosidase; lac operon;
KW   lac repressor protein; lacA gene; lacI gene; lactose permease; lacY gene;
KW   lacZ gene; mutagenesis; palindrome; promoter region;
KW   thiogalactoside acetyltransferase.
XX
OS   Escherichia coli
OC   Bacteria; Proteobacteria; Gammaproteobacteria; Enterobacteriales;
OC   Enterobacteriaceae; Escherichia.
XX
RN   [1]
RP   1243-1266
RX   PUBMED; 4587255.
RA   Gilbert W., Maxam A.;
RT   "The nucleotide sequence of the lac operator";
RL   Proc. Natl. Acad. Sci. U.S.A. 70(12):3581-3584(1973).
XX
RN   [2]
RP   1246-1308
RX   PUBMED; 4587256.
RA   Maizels N.M.;
RT   "The nucleotide sequence of the lactose messenger ribonucleic acid
RT   transcribed from the UV5 promoter mutant of Escherichia coli";
RL   Proc. Natl. Acad. Sci. U.S.A. 70(12):3585-3589(1973).
XX
RN   [3]
RX   PUBMED; 4598642.
RA   Gilbert W., Maizels N., Maxam A.;
RT   "Sequences of controlling regions of the lactose operon";
RL   Cold Spring Harb. Symp. Quant. Biol. 38:845-855(1974).
XX
RN   [4]
RA   Gilbert W., Gralla J., Majors A.J., Maxam A.;
RT   "Lactose operator sequences and the action of lac repressor";
RL   (in) Sund H., Blauer G. (Eds.);
RL   PROTEIN-LIGAND INTERACTIONS:193-207;
RL   Walter de Gruyter, New York (1975)
XX
RN   [5]
RP   1146-1282
RX   PUBMED; 1088926.
RA   Dickson R.C., Abelson J.N., Barnes W.M., Reznikoff W.S.;


  [Part of this file has been deleted for brevity]

     cgatttggct acatgacatc aaccatatca gcaaaagtga tacgggtatt atttttgccg      456
0
     ctatttctct gttctcgcta ttattccaac cgctgtttgg tctgctttct gacaaactcg      462
0
     ggctgcgcaa atacctgctg tggattatta ccggcatgtt agtgatgttt gcgccgttct      468
0
     ttatttttat cttcgggcca ctgttacaat acaacatttt agtaggatcg attgttggtg      474
0
     gtatttatct aggcttttgt tttaacgccg gtgcgccagc agtagaggca tttattgaga      480
0
     aagtcagccg tcgcagtaat ttcgaatttg gtcgcgcgcg gatgtttggc tgtgttggct      486
0
     gggcgctgtg tgcctcgatt gtcggcatca tgttcaccat caataatcag tttgttttct      492
0
     ggctgggctc tggctgtgca ctcatcctcg ccgttttact ctttttcgcc aaaacggatg      498
0
     cgccctcttc tgccacggtt gccaatgcgg taggtgccaa ccattcggca tttagcctta      504
0
     agctggcact ggaactgttc agacagccaa aactgtggtt tttgtcactg tatgttattg      510
0
     gcgtttcctg cacctacgat gtttttgacc aacagtttgc taatttcttt acttcgttct      516
0
     ttgctaccgg tgaacagggt acgcgggtat ttggctacgt aacgacaatg ggcgaattac      522
0
     ttaacgcctc gattatgttc tttgcgccac tgatcattaa tcgcatcggt gggaaaaacg      528
0
     ccctgctgct ggctggcact attatgtctg tacgtattat tggctcatcg ttcgccacct      534
0
     cagcgctgga agtggttatt ctgaaaacgc tgcatatgtt tgaagtaccg ttcctgctgg      540
0
     tgggctgctt taaatatatt accagccagt ttgaagtgcg tttttcagcg acgatttatc      546
0
     tggtctgttt ctgcttcttt aagcaactgg cgatgatttt tatgtctgta ctggcgggca      552
0
     atatgtatga aagcatcggt ttccagggcg cttatctggt gctgggtctg gtggcgctgg      558
0
     gcttcacctt aatttccgtg ttcacgctta gcggccccgg cccgctttcc ctgctgcgtc      564
0
     gtcaggtgaa tgaagtcgct taagcaatca atgtcggatg cggcgcgacg cttatccgac      570
0
     caacatatca taacggagtg atcgcattga acatgccaat gaccgaaaga ataagagcag      576
0
     gcaagctatt taccgatatg tgcgaaggct taccggaaaa aagacttcgt gggaaaacgt      582
0
     taatgtatga gtttaatcac tcgcatccat cagaagttga aaaaagagaa agcctgatta      588
0
     aagaaatgtt tgccacggta ggggaaaacg cctgggtaga accgcctgtc tatttctctt      594
0
     acggttccaa catccatata ggccgcaatt tttatgcaaa tttcaattta accattgtcg      600
0
     atgactacac ggtaacaatc ggtgataacg tactgattgc acccaacgtt actctttccg      606
0
     ttacgggaca ccctgtacac catgaattga gaaaaaacgg cgagatgtac tcttttccga      612
0
     taacgattgg caataacgtc tggatcggaa gtcatgtggt tattaatcca ggcgtcacca      618
0
     tcggggataa ttctgttatt ggcgcgggta gtatcgtcac aaaagacatt ccaccaaacg      624
0
     tcgtggcggc tggcgttcct tgtcgggtta ttcgcgaaat aaacgaccgg gataagcact      630
0
     attatttcaa agattataaa gttgaatcgt cagtttaaat tataaaaatt gcctgatacg      636
0
     ctgcgcttat caggcctaca agttcagcga tctacattag ccgcatccgg catgaacaaa      642
0
     gcgcaggaac aagcgtcgca tcatgcctct ttgacccaca gctgcggaaa acgtactggt      648
0
     gcaaaacgca gggttatgat catcagccca acgacgcaca gcgcatgaaa tgcccagtcc      654
0
     atcaggtaat tgccgctgat actacgcagc acgccagaaa accacggggc aagcccggcg      660
0
     atgataaaac cgattccctg cataaacgcc accagcttgc cagcaatagc cggttgcaca      666
0
     gagtgatcga gcgccagcag caaacagagc ggaaacgcgc cgcccagacc taacccacac      672
0
     accatcgccc acaataccgg caattgcatc ggcagccaga taaagccgca gaaccccacc      678
0
     agttgtaaca ccagcgccag cattaacagt ttgcgccgat cctgatggcg agccatagca      684
0
     ggcatcagca aagctcctgc ggcttgccca agcgtcatca atgccagtaa ggaaccgctg      690
0
     tactgcgcgc tggcaccaat ctcaatatag aaagcgggta accaggcaat caggctggcg      696
0
     taaccgccgt taatcagacc gaagtaaaca cccagcgtcc acgcgcgggg agtgaatacc      702
0
     acgcgaaccg gagtggttgt tgtcttgtgg gaagaggcga cctcgcgggc gctttgccac      708
0
     caccaggcaa agagcgcaac aacggcaggc agcgccacca ggcgagtgtt tgataccagg      714
0
     tttcgctatg ttgaactaac cagggcgtta tggcggcacc aagcccaccg ccgcccatca      720
0
     gagccgcgga ccacagcccc atcaccagtg gcgtgcgctg ctgaaaccgc cgtttaatca      726
0
     ccgaagcatc accgcctgaa tgatgccgat ccccacccca ccaagcagtg cgctgctaag      732
0
     cagcagcgca ctttgcgggt aaagctcacg catcaatgca ccgacggcaa tcagcaacag      738
0
     actgatggcg acactgcgac gttcgctgac atgctgatga agccagcttc cggccagcgc      744
0
     cagcccgccc atggtaacca ccggcagagc ggtcgac                               747
7
//

   You can specifiy a file of ranges to display in uppercase by giving
   the '-uppercase' qualifier the value '@' followed by the name of the
   file containing the ranges. (eg: '-upper @myfile').

   The format of the range file is:

     * Comment lines start with '#' in the first column.
     * Comment lines and blank lines are ignored.
     * The line may start with white-space.
     * There are two positive (integer) numbers per line separated by one
       or more space or TAB characters.
     * The second number must be greater or equal to the first number.
     * There can be optional text after the two numbers to annotate the
       line.
     * White-space before or after the text is removed.

   An example range file is:

# this is my set of ranges
12   23
 4   5       this is like 12-23, but smaller
67   10348   interesting region

   You can specifiy a file of ranges to highlight in a different colour
   when outputting in HTML format (using the '-html' qualifier) by giving
   the '-highlight' qualifier the value '@' followed by the name of the
   file containing the ranges. (eg: '-highlight @myfile').

   The format of this file is very similar to the format of the above
   uppercase range file, except that the text after the start and end
   positions is used as the HTML colour name. This colour name is used
   'as is' when specifying the colour in HTML in a '<FONT COLOR=xxx>'
   construct, (where 'xxx' is the name of the colour).

   The standard names of HTML font colours are given in:
   http://http://www.w3.org/TR/REC-html40/types.html and
   http://www.ausmall.com.au/freegraf/ncolour2.htm and
   http://mindprod.com/htmlcolours.html (amongst other places).

   An example highlight range file is:
     _________________________________________________________________

# this is my set of ranges
12   23         red
 4   5          darkturquoise
67   10348      #FFE4E1
     _________________________________________________________________

Output file format

  Output files for usage example

  File: j01636.remap

J01636
E.coli lactose operon with lacI, lacZ, lacY and lacA genes.

                                                        BssKI
                 TaqI                 AciI              Ksp632I
                 \                    \                 \
          gacaccatcgaatggcgcaaaacctttcgcggtatggcatgatagcgcccggaagagagt
                   10        20        30        40        50        60
          ----:----|----:----|----:----|----:----|----:----|----:----|
          ctgtggtagcttaccgcgttttggaaagcgccataccgtactatcgcgggccttctctca
                   /                    /                  / /
                   TaqI                 AciI               | BssKI
                                                           Ksp632I


# Enzymes that cut  Frequency   Isoschizomers
      AciI          1
     BssKI          1
   Ksp632I          1   Bsu6I
      TaqI          1



# Enzymes which cut less frequently than the MINCUTS criterion
# Enzymes < MINCUTS Frequency   Isoschizomers



# Enzymes which cut more frequently than the MAXCUTS criterion
# Enzymes > MAXCUTS Frequency   Isoschizomers



# Enzymes that do not cut




# No. of cutting enzymes which do not match the
# SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS citeria

0

  Output files for usage example 2

  File: j01636.remap

J01636
E.coli lactose operon with lacI, lacZ, lacY and lacA genes.

                                                      Hin6I
                 TaqI                                 | HhaI
                 |  BsiYI                             | BssKI
                 |  |   Hin6I                         | Ksp632I
                 |  |   | HhaI        AciI            | | HpaII
                 \  \   \ \           \               \ \ \
          gacaccatcgaatggcgcaaaacctttcgcggtatggcatgatagcgcccggaagagagt
                   10        20        30        40        50        60
          ----:----|----:----|----:----|----:----|----:----|----:----|
          ctgtggtagcttaccgcgttttggaaagcgccataccgtactatcgcgggccttctctca
                 / /    / /             /             / /  ///
                 | TaqI | Hin6I         AciI          | |  ||BssKI
                 BsiYI  HhaI                          | |  |HpaII
                                                      | |  Ksp632I
                                                      | Hin6I
                                                      HhaI


# Enzymes that cut  Frequency   Isoschizomers
      AciI          1
     BsiYI          1   Bsc4I
     BssKI          1
      HhaI          2
     Hin6I          2   HinP1I,HspAI
     HpaII          1   BsiSI
   Ksp632I          1   Bsu6I
      TaqI          1



# Enzymes which cut less frequently than the MINCUTS criterion
# Enzymes < MINCUTS Frequency   Isoschizomers



# Enzymes which cut more frequently than the MAXCUTS criterion
# Enzymes > MAXCUTS Frequency   Isoschizomers



# Enzymes that do not cut

AclI      BamHI     BceAI     BseYI     BsrI      ClaI      EcoRI     EcoRII

HaeIII    Hin4I     HindII    HindIII   KpnI      MaeII     NotI


# No. of cutting enzymes which do not match the
# SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS citeria

0

  Output files for usage example 3

  File: j01636.remap

J01636
E.coli lactose operon with lacI, lacZ, lacY and lacA genes.

                                                      HspAI
                                                      Hin6I
                 TaqI                                 HinP1I
                 |  BsiYI                             | HhaI
                 |  Bsc4I                             | Bsu6I
                 |  |   HspAI                         | BssKI
                 |  |   Hin6I                         | Ksp632I
                 |  |   HinP1I                        | | HpaII
                 |  |   | HhaI        AciI            | | BsiSI
                 \  \   \ \           \               \ \ \
          gacaccatcgaatggcgcaaaacctttcgcggtatggcatgatagcgcccggaagagagt
                   10        20        30        40        50        60
          ----:----|----:----|----:----|----:----|----:----|----:----|
          ctgtggtagcttaccgcgttttggaaagcgccataccgtactatcgcgggccttctctca
                 / /    / /             /             / /  ///
                 | TaqI | HinP1I        AciI          | |  ||BssKI
                 Bsc4I  | Hin6I                       | |  |BsiSI
                 BsiYI  | HspAI                       | |  |HpaII
                        HhaI                          | |  Ksp632I
                                                      | |  Bsu6I
                                                      | HinP1I
                                                      | Hin6I
                                                      | HspAI
                                                      HhaI


# Enzymes that cut  Frequency
      AciI          1
     Bsc4I          1
     BsiSI          1
     BsiYI          1
     BssKI          1
     Bsu6I          1
      HhaI          2
     Hin6I          2
    HinP1I          2
     HpaII          1
     HspAI          2
   Ksp632I          1
      TaqI          1



# Enzymes which cut less frequently than the MINCUTS criterion
# Enzymes < MINCUTS Frequency



# Enzymes which cut more frequently than the MAXCUTS criterion
# Enzymes > MAXCUTS Frequency



# Enzymes that do not cut

AclI      BamHI     BceAI     Bse1I     BseYI     BshI      BsrI      ClaI

EcoRI     EcoRII    HaeIII    Hin4I     HindII    HindIII   HpyCH4IV  KpnI

MaeII     NotI


# No. of cutting enzymes which do not match the
# SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS citeria

0

  Output files for usage example 4

  File: j01636.remap

J01636
E.coli lactose operon with lacI, lacZ, lacY and lacA genes.

                                                                  Ksp632I
                                                        >.........====
                                                          HpaII
                                                          >===
                        HhaI                             BssKI
                        ==>=                            >=====
                 TaqI   Hin6I                         HhaI
                 >===   >===                          ==>=
              BsiYI                      AciI         Hin6I
              ======>====             >..====         >===
          gacaccatcgaatggcgcaaaacctttcgcggtatggcatgatagcgcccggaagagagt
                   10        20        30        40        50        60
          ----:----|----:----|----:----|----:----|----:----|----:----|
          ctgtggtagcttaccgcgttttggaaagcgccataccgtactatcgcgggccttctctca
              ====<======                <===         ===<
              BsiYI                      AciI         Hin6I
                 ===<   ===<                          =<==  <.....====
                 TaqI   Hin6I                         HhaI        Ksp632I
                        =<==                             =====<
                        HhaI                             BssKI
                                                          ===<
                                                          HpaII


# Enzymes that cut  Frequency   Isoschizomers
      AciI          1
     BsiYI          1   Bsc4I
     BssKI          1
      HhaI          2
     Hin6I          2   HinP1I,HspAI
     HpaII          1   BsiSI
   Ksp632I          1   Bsu6I
      TaqI          1



# Enzymes which cut less frequently than the MINCUTS criterion
# Enzymes < MINCUTS Frequency   Isoschizomers



# Enzymes which cut more frequently than the MAXCUTS criterion
# Enzymes > MAXCUTS Frequency   Isoschizomers



# Enzymes that do not cut

AclI      BamHI     BceAI     BseYI     BsrI      ClaI      EcoRI     EcoRII

HaeIII    Hin4I     HindII    HindIII   KpnI      MaeII     NotI


# No. of cutting enzymes which do not match the
# SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS citeria

0

   The name of the sequence is displayed, followed by the description of
   the sequence.

   The formatted display of cut sites on the sequence follows, with the
   six-frame translation below it. The cut sites are indicated by a slash
   character '\' that points to the poition between the nucleotides where
   the cuts occur. Cuts by many enzymes at the same position are
   indicated by stacking the enzyme names on top of each other.

   At the end the section header 'Enzymes that cut' is displayed followed
   by a list of the enzymes that cut the specified sequence and the
   number of times that they cut. For each enzyme that cuts, a list of
   isoschizomers of that enzyme (sharing the same recognition site
   pattern and cut sites) is given.

   This is followed by lists of the enzymes that do cut, but which cut
   less often than the '-mincut' qualifier or more often than the
   '-maxcut' qualifier.

   Any of the isoschizomers that are excluded from cutting, (either
   through restrictions such as the permitted number of cuts, blunt
   cutters only, single cutters only etc. or because their name has not
   been given in the input list of enzymes), will not be listed.

   Then a list is displayed of the enzymes whose names were input and
   which match the other criteria ('-sitelen', '-blunt', '-sticky',
   '-ambiguity' or '-commercial') but which do not cut.

   Finally the number of enzymes that were rejected from consideration
   because they do not match the '-sitelen', '-blunt', '-sticky',
   '-ambiguity' or '-commercial' criteria is displayed.

   The '-flatreformat' qualifier changes the display to emphasise the
   recognition site of the restriction enzyme, which is indicated by a
   row of '=' characters. The cut site if pointed to by a '>' or '<'
   character and if the cut site is not within or imemdiately adjacent to
   the recognition site, they are linked by a row of '.' characters.

   The name of the enzyme is displayed above (or below when the reverse
   sense site if displayed) the recognition site. The name of the enzyme
   is also displayed above the cut site if this occurs on a different
   display line to the recognition site (i.e. if it wraps onto the next
   line of sequence).

Data files

   EMBOSS data files are distributed with the application and stored in
   the standard EMBOSS data directory, which is defined by the EMBOSS
   environment variable EMBOSS_DATA.

   To see the available EMBOSS data files, run:

% embossdata -showall

   To fetch one of the data files (for example 'Exxx.dat') into your
   current directory for you to inspect or modify, run:

% embossdata -fetch -file Exxx.dat

   Users can provide their own data files in their own directories.
   Project specific files can be put in the current directory, or for
   tidier directory listings in a subdirectory called ".embossdata".
   Files for all EMBOSS runs can be put in the user's home directory, or
   again in a subdirectory called ".embossdata".

   The directories are searched in the following order:
     * . (your current directory)
     * .embossdata (under your current directory)
     * ~/ (your home directory)
     * ~/.embossdata

   The EMBOSS REBASE restriction enzyme data files are stored in
   directory 'data/REBASE/*' under the EMBOSS installation directory.

   These files must first be set up using the program 'rebaseextract'.
   Running 'rebaseextract' may be the job of your system manager.

   The data files are stored in the REBASE directory of the standard
   EMBOSS data directory. The names are:
     * embossre.enz Cleavage information
     * embossre.ref Reference/methylation information
     * embossre.sup Supplier information

   The column information is described at the top of the data files

   The reported enzyme from any one group of isoschizomers (the
   prototype) is specified in the REBASE database and the information is
   held in the data file 'embossre.equ'. You may edit this file to set
   your own preferred prototype, if you wish.

   The format of the file "embossre.equ" is
   Enzyme-name Prototype-name

   i.e. two columns of enzyme names separated by a space. The first name
   of the pair of enzymes is the name that is not preferred and the
   second is the preferred (prototype) name.

Notes

   The Restriction Enzyme database (REBASE) is a collection of
   information about restriction enzymes and related proteins. It
   contains published and unpublished references, recognition and
   cleavage sites, isoschizomers, commercial availability, methylation
   sensitivity, crystal and sequence data. DNA methyltransferases, homing
   endonucleases, nicking enzymes, specificity subunits and control
   proteins are also included. Most recently, putative DNA
   methyltransferases and restriction enzymes, as predicted from analysis
   of genomic sequences, are also listed.

   The home page of REBASE is: http://rebase.neb.com/

   Where the translation is given in the output file, the genetic code
   and one or more frames for translation may be specified. The
   -no[reverse] option specifies whether the translation (and cut and
   recognition sites) are shown for the reverse sense strand.

   By default, only one enzyme of any group of isoschizomers (enzymes
   that have the same recognition site and cut positions) is reported.
   This behaviour can be changed by specifying -nolimit, in which case
   all isoschizomers are reported. The default behaviour uses the
   representative enzyme of an isoschizomer group (the prototype) which
   is specified in the EMBOSS data file embossre.equ. This file is
   generated from the REBASE database by running rebaseextract. You may
   edit this file to set your own preferred prototype, if you wish.

   As well as the display of where enzymes cut in the sequence, remap
   displays:
     * The list of enzymes that cut the sequence and match the required
       criteria.
     * The list of enzymes that cut the sequence and fail the MINCUTS
       criteria.
     * The list of enzymes that cut the sequence and fail the MAXCUTS
       criteria.
     * The list of enzymes that do not cut the sequence but which match
       all the required criteria.
     * The number of enzymes that cut the sequence and fail the SITELEN,
       BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria.

References

   None.

Warnings

   remap uses the EMBOSS REBASE restriction enzyme data files stored in
   directory data/REBASE/* under the EMBOSS installation directory. These
   files must first be set up using the program rebaseextract. Running
   rebaseextract may be the job of your system manager.

Diagnostic Error Messages

   None.

Exit status

   It always exits with status 0.

Known bugs

   None.

See also

   Program name Description
   abiview Display the trace in an ABI sequencer file
   backtranambig Back-translate a protein sequence to ambiguous
   nucleotide sequence
   backtranseq Back-translate a protein sequence to a nucleotide sequence
   cirdna Draws circular maps of DNA constructs
   coderet Extract CDS, mRNA and translations from feature tables
   lindna Draws linear maps of DNA constructs
   pepnet Draw a helical net for a protein sequence
   pepwheel Draw a helical wheel diagram for a protein sequence
   plotorf Plot potential open reading frames in a nucleotide sequence
   prettyplot Draw a sequence alignment with pretty formatting
   prettyseq Write a nucleotide sequence and its translation to file
   recoder Find restriction sites to remove (mutate) with no translation
   change
   redata Retrieve information from REBASE restriction enzyme database
   restover Find restriction enzymes producing a specific overhang
   restrict Report restriction enzyme cleavage sites in a nucleotide
   sequence
   seealso Finds programs with similar function to a specified program
   showalign Display a multiple sequence alignment in pretty format
   showdb Displays information on configured databases
   showfeat Display features of a sequence in pretty format
   showorf Display a nucleotide sequence and translation in pretty format
   showseq Displays sequences with features in pretty format
   silent Find restriction sites to insert (mutate) with no translation
   change
   sixpack Display a DNA sequence with 6-frame translation and ORFs
   textsearch Search the textual description of sequence(s)
   transeq Translate nucleic acid sequences

Author(s)

   Gary Williams (gwilliam  rfcgr.mrc.ac.uk)
   MRC Rosalind Franklin Centre for Genomics Research Wellcome Trust
   Genome Campus, Hinxton, Cambridge, CB10 1SB, UK

History

   Written Spring 2000

   Changed 7 Dec 2000 - GWW - to declare isoschizomers that cut

Target users

   This program is intended to be used by everyone and everything, from
   naive users to embedded scripts.

Comments

   None
